complementSeq {Biostrings} | R Documentation |
WARNING: complementSeq
has been
deprecated in favor of complement
.
Function to obtain the complementary sequence.
complementSeq(seq, start=1, stop=0)
seq |
Character vector consisting of the letters A, C, G and T. |
start |
Numeric scalar: the sequence position at which to start complementing. If 1, start from the beginning. |
stop |
Numeric scalar: the sequence position at which to stop complementing. If 0, go until the end. |
The complemented sequence for each element of the input is computed and returned. The complement is given by the mapping: A -> T, C -> G, G -> C, T -> A.
An important special case is start=13
, stop=13
:
If seq
is a vector of 25mer sequences on an Affymetrix
GeneChip, complementSeq(seq, start=13, stop=13)
calculates the so-called mismatch sequences.
The function deals only with sequences that represent DNA.
These can consist only of the letters A
, C
, T
or G
. Upper, lower or mixed case is allowed and honored.
A character vector of the same length as seq
is
returned. Each component represents the transformed sequence for the
input value.
R. Gentleman, W. Huber
alphabetFrequency
, reverseComplement
## --------------------------------------------------------------------- ## EXAMPLE 1 ## --------------------------------------------------------------------- seq <- c("AAACT", "GGGTT") ## Don't do this anymore (deprecated): if (interactive()) { complementSeq(seq) # inefficient on large vectors } ## But do this instead: complement(DNAStringSet(seq)) # more efficient ## --------------------------------------------------------------------- ## EXAMPLE 2 ## --------------------------------------------------------------------- seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT") ## Don't do this anymore (deprecated): if (interactive()) { complementSeq(seq, start=13, stop=13) } ## But do this instead: pm2mm <- function(probes) { probes <- DNAStringSet(probes) subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13)) probes } pm2mm(seq) ## --------------------------------------------------------------------- ## SPEED OF complementSeq() VS complement() ## --------------------------------------------------------------------- if (interactive()) { library(hgu95av2probe) system.time(y1 <- complementSeq(hgu95av2probe$sequence)) probes <- DNAStringSet(hgu95av2probe$sequence) system.time(y2 <- complement(probes)) }